File:20190523 152846 0579 M.jpg

Original file (5,855 × 4,378 pixels, file size: 18.24 MB, MIME type: image/jpeg)

Captions

Captions

Add a one-line explanation of what this file represents

Summary

edit
Description
English: Orthosia cruda caterpillar on oak (Quercus sp.)

ID based on barcoding : CRAW_ID : AB2019_03_A003_01 Consensus and clipped sequence for COI from LCO/HCO primers :

TTTATTTTTGGATTTGAGCTGGAATAGTTGGAACTTCATTAAGATTGTTAATTCGAGCCGAATTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACAGCGCATGCCTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTCGGCAATTGACTTGTTCCATTAATATTAGGTGCCCCTGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGACTTCTACCCCCCTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACGGTATATCCCCCCCTTTCGTCTAACATTGCTCACGGAGGAAGATCTGTTGACTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCCTCTATTTTAGGAGCTATTAACTTTATTACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGTATTACTGCATTTTTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATCTAAATACATCCTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTT
Date
Source Own work
Author Gilles San Martin
Camera location50° 24′ 11.03″ N, 4° 55′ 27.76″ E Kartographer map based on OpenStreetMap.View this and other nearby images on: OpenStreetMapinfo

Licensing

edit
I, the copyright holder of this work, hereby publish it under the following license:
w:en:Creative Commons
attribution share alike
This file is licensed under the Creative Commons Attribution-Share Alike 4.0 International license.
You are free:
  • to share – to copy, distribute and transmit the work
  • to remix – to adapt the work
Under the following conditions:
  • attribution – You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.
  • share alike – If you remix, transform, or build upon the material, you must distribute your contributions under the same or compatible license as the original.

File history

Click on a date/time to view the file as it appeared at that time.

Date/TimeThumbnailDimensionsUserComment
current04:12, 13 December 2019Thumbnail for version as of 04:12, 13 December 20195,855 × 4,378 (18.24 MB)GillesSM (talk | contribs)User created page with UploadWizard

There are no pages that use this file.

Metadata