File:Nussinov78 AF083069.1 1-43.svg
![File:Nussinov78 AF083069.1 1-43.svg](https://upload.wikimedia.org/wikipedia/commons/thumb/6/6f/Nussinov78_AF083069.1_1-43.svg/512px-Nussinov78_AF083069.1_1-43.svg.png?20080613193645)
Size of this PNG preview of this SVG file: 512 × 512 pixels. Other resolutions: 240 × 240 pixels | 480 × 480 pixels | 768 × 768 pixels | 1,024 × 1,024 pixels | 2,048 × 2,048 pixels.
Original file (SVG file, nominally 512 × 512 pixels, file size: 24 KB)
File information
Structured data
Captions
Captions
Add a one-line explanation of what this file represents
Summary
editDescriptionNussinov78 AF083069.1 1-43.svg | Secondary structure of a maximal basepairing of a RNA subsequence of the Echovirus 5 genome (EMBL Accession number AF083069.1_1-43). This structure is predicted with the Nussinov 78 algorithm und is one of 42 optimal structures. The input sequence is "UUAAAACAGCCUGUGGGUUGCACCCACCCACAGGGCCCACUGG" and the dot-bracket string of the shown secondary structure is "(())..(.()(((((((((())...)))))))((()))(.)))". The image was created and exported with RNAMovies 2.04 as svg. To correct the margin it was edited with Inkscape. |
Source | Own work |
Author | Bgw |
Licensing
editI, the copyright holder of this work, hereby publish it under the following licenses:
![w:en:Creative Commons](https://upload.wikimedia.org/wikipedia/commons/thumb/7/79/CC_some_rights_reserved.svg/90px-CC_some_rights_reserved.svg.png)
![attribution](https://upload.wikimedia.org/wikipedia/commons/thumb/1/11/Cc-by_new_white.svg/24px-Cc-by_new_white.svg.png)
![share alike](https://upload.wikimedia.org/wikipedia/commons/thumb/d/df/Cc-sa_white.svg/24px-Cc-sa_white.svg.png)
This file is licensed under the Creative Commons Attribution-Share Alike 3.0 Unported license.
- You are free:
- to share – to copy, distribute and transmit the work
- to remix – to adapt the work
- Under the following conditions:
- attribution – You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.
- share alike – If you remix, transform, or build upon the material, you must distribute your contributions under the same or compatible license as the original.
![]() |
Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.2 or any later version published by the Free Software Foundation; with no Invariant Sections, no Front-Cover Texts, and no Back-Cover Texts. A copy of the license is included in the section entitled GNU Free Documentation License.http://www.gnu.org/copyleft/fdl.htmlGFDLGNU Free Documentation Licensetruetrue |
You may select the license of your choice.
File history
Click on a date/time to view the file as it appeared at that time.
Date/Time | Thumbnail | Dimensions | User | Comment | |
---|---|---|---|---|---|
current | 19:36, 13 June 2008 | ![]() | 512 × 512 (24 KB) | Bgw (talk | contribs) | {{Information |Description= |Source= |Date= |Author= |Permission= |other_versions= }} |
19:29, 13 June 2008 | ![]() | 744 × 1,052 (24 KB) | Bgw (talk | contribs) | {{Information |Description=Secondary structure of a maximal basepairing of a RNA subsequence of the Echovirus 5 genome (EMBL Accession number AF083069.1_1-43). This structure is predicted with the Nussinov 78 algorithm und is one of 42 optimal structures. |
You cannot overwrite this file.
File usage on Commons
There are no pages that use this file.
File usage on other wikis
The following other wikis use this file:
- Usage on ar.wikipedia.org
- Usage on ca.wikipedia.org
- Usage on de.wikipedia.org
- Usage on es.wikipedia.org
- Usage on fa.wikipedia.org
- Usage on fr.wikipedia.org
- Usage on hi.wikipedia.org
- Usage on ko.wikipedia.org
- Usage on pt.wikipedia.org
- Usage on ru.wikipedia.org
- Usage on species.wikimedia.org
- Usage on uk.wikipedia.org
- Usage on www.wikidata.org
- Usage on zh.wikipedia.org